A statistical pairwise and multiple (in development) sequence aligner that is robust to artifacts, incorporates codon models, and supports complex indels.
- Installation
alignpair- Pairwise alignmentsample- Sample alignmentsgenseed- Generate a random seedformat- Utility command to format sequencesmsa- Multiple sequence aligner- Input/output syntax details
Source code for the most recent beta versions is available at https://github.com/CartwrightLab/coati/archive/master.tar.gz
- Recent C++ compiler, supporting C++17 (e.g. gcc 8+ or clang 5+)
- Meson 0.59+
- Ninja 1.8.2+
- Boost 1.47+
tar -xvzf coati*.tar.gz
meson setup builddir --buildtype=release
meson compile -C builddirtar -xvzf coati*.tar.gz
meson setup builddir --buildtype=release
meson compile -C builddir
meson install -C builddirPairwise alignment of nucleotide sequences via composition of finite-state transducers (FSTs) or using Gotoh's algorithm. Substitution models available:
- tri-mg94: Muse and Gaut codon model using finite-state transducers.
- tri-ecm: empirical codon model using FSTs.
- dna: dna model resulting of marginalizing Muse and Gaut's model using FSTs.
- mar-mg94: marginal Muse and Gaut using Gotoh's algorithm.
- mar-ecm: marginal empirical codon model using Gotoh's algorithm.
Indel model allows gaps of any length at any position. Insertion always precede deletions when contiguous to eliminate equivalent alignments.
coati alignpair - pairwise alignment of nucleotide sequences
Usage: coati alignpair [OPTIONS] input
Positionals:
input TEXT REQUIRED Input file (FASTA/PHYLIP/JSON accepted)
Options:
-h,--help Print this help message and exit
-s,--score Score input alignment and exit
-o,--output TEXT Alignment output file
Model parameters:
-m,--model TEXT Excludes: --sub Substitution model (dna tri-mg tri-ecm mar-mg mar-ecm)
-t,--time FLOAT:POSITIVE Evolutionary time/branch length
-g,--gap-open FLOAT:POSITIVE Gap opening score
-e,--gap-extend FLOAT:POSITIVE Gap extension score
-k,--gap-len UINT Gap unit length
Advanced options:
--sub TEXT Excludes: --model File with branch lengths and codon subst matrix
-r,--ref TEXT Excludes: --rev-ref
Name of reference sequence (default: 1st seq)
-v,--rev-ref Excludes: --ref Use 2nd seq as reference (default: 1st seq)
-w,--omega FLOAT:POSITIVE Nonsynonymous-synonymous bias
-p,--pi FLOAT x 4 Nucleotide frequencies (A C G T)
-x,--sigma FLOAT x 6 GTR sigma parameters (AC AG AT CG CT GT)
-b,--base-error FLOAT:POSITIVE Base calling error rate
#Align file example-001.fasta with marginal model (default) and output in JSON
format (default)
coati alignpair sampledata/example-001.fasta
# Align file example-002.fasta with m-ecm model and output in fasta format
coati alignpair sampledata/example-002.fasta -m m-ecm -o example-002.fasta
# Align file example-003.fasta with ecm model, PHY output, and save alignment weight to w.out
coati alignpair sampledata/example-003.fasta -m ecm -l w.out
# Align file example-003.fasta with m-coati model, specifying a branch length of 0.0133 and underlying nucleotide frequencies A:0.3, C:0.2, C:0.2, T:0.3
coati alignpair sampledata/example-003.fasta -t 0.0133 -p 0.3 0.2 0.2 0.3Align a pair of sequences and get alignments from Gotoh's dynamic programming matrices with sampling (not necessarily best alignment). Output is always in json format (see input output syntax) and provides a weight and log weight of each pairwise alignment sampled.
coati sample - align two sequences and sample alignments
Usage: coati sample [OPTIONS] input
Positionals:
input TEXT REQUIRED Input file (FASTA/PHYLIP/JSON accepted)
Options:
-h,--help Print this help message and exit
-o,--output TEXT Alignment output file
-n,--sample-size UINT Sample size
-s,--seed TEXT ... Space separated list of seed(s) used for sampling
Model parameters:
-t,--time FLOAT:POSITIVE Evolutionary time/branch length
-m,--model TEXT Excludes: --sub Substitution model (coati ecm dna m-coati m-ecm)
-g,--gap-open FLOAT:POSITIVE Gap opening score
-e,--gap-extend FLOAT:POSITIVE Gap extension score
-k,--gap-len UINT Gap unit length
Advanced options:
--sub TEXT Excludes: --model File with branch lengths and codon subst matrix
-w,--omega FLOAT:POSITIVE Nonsynonymous-synonymous bias
-p,--pi FLOAT x 4 Nucleotide frequencies (A C G T)
-x,--sigma FLOAT x 6 GTR sigma parameters (AC AG AT CG CT GT)
# Sample 100 alignments from example-003.fasta and save to `ex3_100.json`.
coati sample sampledata/example-003.fasta -n 100 -o ex3_100.json
# Sample 50 alignments from example-003.fasta specifying seed
coati sample sampledata/example-003.fasta -n 50 -s random42Generate a random seed. Usage:
coati genseedConvert between formats, extract and/or reorder sequences. Accepted format are FASTA, PHYLIP, and JSON formats. Output can be piped to other commands.
Additionaly, coati format can adjust sequences aligned with coati alignpair
or coati msa to be used with downstream analyses and maintain our model
assumption that the reference is always in frame.
coati format - convert between formats, extract and/or reoder sequences
Usage: coati format [OPTIONS] input
Positionals:
input TEXT REQUIRED Input file (FASTA/PHYLIP/JSON accepted)
Options:
-h,--help Print this help message and exit
-o,--output TEXT Alignment output file
-p,--preserve-phase Preserve phase
-c,--padding TEXT Needs: --preserve-phase
Padding char to format preserve phase
-s,--cut-seqs TEXT ... Excludes: --cut-pos
Name of sequences to extract
-x,--cut-pos UINT ... Excludes: --cut-seqs
Position of sequences to extract (1 based)
# Extract first two sequences and align them with alignpair
coati format sampledata/example-msa-001.fasta -x 1 2 | coati alignpair json:-
# Extract sequences C B D (in that order) and convert to PHYLIP format
coati format sampledata/example-msa-002.fasta -s C B D -o ex-msa-2.phy
# Align then preserve phase using '?' character
coati alignpair sampledata/example-003.fasta | coati format json:- -p -c '?'Multiple sequence alignment (still in development).
coati msa - multiple sequence alignment of nucleotide sequences
Usage: coati msa [OPTIONS] input tree reference
Positionals:
input TEXT REQUIRED Input file (FASTA/PHYLIP/JSON accepted)
tree TEXT:FILE REQUIRED Newick phylogenetic tree
reference TEXT REQUIRED Name of reference sequence
Options:
-h,--help Print this help message and exit
-o,--output TEXT Alignment output file
Model parameters:
-m,--model TEXT Substitution model (mar-mg94 mar-ecm)
-g,--gap-open FLOAT:POSITIVE Gap opening score
-e,--gap-extend FLOAT:POSITIVE Gap extension score
-k,--gap-len UINT Gap unit length
Advanced options:
-w,--omega FLOAT:POSITIVE Nonsynonymous-synonymous bias
-p,--pi FLOAT x 4 Nucleotide frequencies (A C G T)
-x,--sigma FLOAT x 6 GTR sigma parameters (AC AG AT CG CT GT)
Syntax for input and output files is [format:]filename.extension where format
is optional (indicated by []).
Format must be one of "fa", "fasta" (FASTA format), "phy" (PHYLIP format), or
"json" (JSON format).
If no format is specified, then extension must also be one of the above.
Alternatively, input can be of the form format:- or format: and COATi will
read from the command line (std::cin);
This allows the different COATi commands to work in a pipeline.
The JSON input and output (except for sample) JSON format is as follows:
{
"data": {
"names": ["A","B","C","D","E"],
"seqs":["TCA--TCG","TCA-GTCG","T-A--TCG","TCAC-TCG","TCA--TC-"]
}
}The output from sample is always in the following JSON format:
[
{
"aln": {
"1": "CTCTGGATAGTG",
"2": "CT----ATAGTG"
},
"weight": 0.994785,
"log_weight": -0.00522821
},
{
"aln": {
"1": "CTCTGGATAGTG",
"2": "CT----ATAGTG"
},
"weight": 0.994785,
"log_weight": -0.00522821
},
{
"aln": {
"1": "CTCTGGATAGTG",
"2": "CT----ATAGTG"
},
"weight": 0.994785,
"log_weight": -0.00522821
}
]
PHYLIP format limits names to 10 characters and uses interleaved format:
3 110
A CCTACTCACTAGGAACAATTCTAAGGTTAT--------------------
B CCTACTCACGACGAACAAGTTTAAGGTTATATGACACTTCTCCGATTGTC
VeryLongNaCCTACTCACTAGGAACAATTCTAAGGTTAT--------------------
-----GTTCCACTTCACCAAGTGTCGCATGTCGTCCACAGGTGTTCATTG----GCTCAA
GCAAGG-------------------------CGTCTACAGGTGTTCATTGTTACG----A
-----GTTCCACTTCACCAAGTGTCGCATGTCGTCCACAGGTGTTCATTGTTACG----A